70005 T7SelectUP Primer

70005
Price could not be retrieved
Minimum Quantity needs to be mulitiple of
Upon Order Completion More Information
You Saved ()
 
Request Pricing
Limited AvailabilityLimited Availability
Stocked 
Discontinued
Limited Quantities Available
Available
    Remaining : Will advise
      Remaining : Will advise
      Will advise
      Contact Customer Service
      Contact Customer Service
      View Pricing & Availability

      Overview

      Replacement Information

      Pricing & Availability

      Catalog Number AvailabilityPackaging Qty/Pack Price Quantity
      70005-3
      Retrieving availability...
      Limited AvailabilityLimited Availability
      Stocked 
      Discontinued
      Limited Quantities Available
      Available
        Remaining : Will advise
          Remaining : Will advise
          Will advise
          Contact Customer Service
          Contact Customer Service

          Plastic ampoule 500 pmol
          Retrieving price...
          Price could not be retrieved
          Minimum Quantity needs to be mulitiple of
          Upon Order Completion More Information
          You Saved ()
           
          Request Pricing
          Description
          OverviewT7Select Vector primers are convenient for amplification and sequencing of T7Select recombinants, and are compatible with all T7Select vectors.
          Mr: 6105
          Catalogue Number70005
          Brand Family Novagen®
          References
          Product Information
          Oligo seqence5ʹ - GGAGCTGTCGTATTCCAGTC - 3ʹ
          Applications
          Biological Information
          Physicochemical Information
          Dimensions
          Materials Information
          Toxicological Information
          Safety Information according to GHS
          Safety Information
          Product Usage Statements
          Storage and Shipping Information
          Ship Code Shipped with Blue Ice or with Dry Ice
          Toxicity Standard Handling
          Storage -20°C
          Avoid freeze/thaw Avoid freeze/thaw
          Do not freeze Ok to freeze
          Packaging Information
          Transport Information
          Supplemental Information
          Specifications

          Documentation

          T7SelectUP Primer SDS

          Title

          Safety Data Sheet (SDS) 

          T7SelectUP Primer Certificates of Analysis

          TitleLot Number
          70005

          Citations

          Title
        • Bryan M. Wittmann, Andrea Sherk and Donald P. McDonnell. (2007) Definition of functionally important mechanistic differences among selective estrogen receptor down-regulators. Cancer Research 67, 9549-9560.
        • Jinguo Chen, et al. (2005) Tachyplesin activates the classic complement pathway to kill tumor cells. Cancer Research 65, 4614-4622.
        • Hoyee Leong, et al. (2005) Recruitment of histone deacetylase 4 to the N-terminal region of estrogen receptor alpha. Molecular Endocrinology 19, 2930-2942.
        • Ulrika Karlson, et al. (2002) Rat mast cell protease 4 is a β-chymase with unusually stringent substrate recognition profile. Journal of Biological Chemistry 277, 18579-18585.
        • Related Products & Applications

          Related Products

          Catalog Number Description  
          70006 T7SelectDOWN Primer Show Pricing & Availability

          Related Products By: Brand Facete

          Categories

          Life Science Research > Genomic Analysis > DNA Preparation & Cloning > Primers